Twelve Books

Twelve Books Twelve strives to publish the singular book by authors who have a unique perspective and compelling authority. TWELVE was established in August 2005 with the objective of publishing no more than twelve books each year.

We strive to publish the singular book, by authors who have a unique perspective and compelling authority. Works that explain our culture; that illuminate, inspire, provoke, and entertain. We seek to establish communities of conversation surrounding our books. Talented authors deserve attention not only from publishers, but from readers as well. To sell the book is only the beginning of our mission. To build avid audiences of readers who are enriched by these works–that is our ultimate purpose

Congratulations to our SIX New York Times Bestseller's books in SIX months! We couldn't have done it without the incredi...
07/22/2021

Congratulations to our SIX New York Times Bestseller's books in SIX months!
We couldn't have done it without the incredible support from our authors: @DanaPerino, @SenDuckworth, @SusanPage, Jean Becker, @GaryLeeGinsberg, @MichaelCBender.

#NYTbestseller

Congratulations to our SIX New York Times Bestseller's books in SIX months!
We couldn't have done it without the incredible support from our authors: @DanaPerino, @SenDuckworth, @SusanPage, Jean Becker, @GaryLeeGinsberg, @MichaelCBender.

#NYTbestseller

Photos from George W. Bush's post
06/14/2021

Photos from George W. Bush's post

Jean Becker, author of THE MAN I KNEW, will be in conversation with Jon Meacham and Chris Buckley on Monday, June 7th at...
06/03/2021

Jean Becker, author of THE MAN I KNEW, will be in conversation with Jon Meacham and Chris Buckley on Monday, June 7th at 6pm CT.
Register for this World Affairs Council of Dallas/Fort Worth virtual event below!

GeorgeHWBush #TheManIKnew #FortyOne

https://www.dfwworld.org/events?cgid=1&ceid=267020&cerid=0&cdt=6%2F7%2F2021

Jean Becker, author of THE MAN I KNEW, will be in conversation with Jon Meacham and Chris Buckley on Monday, June 7th at 6pm CT.
Register for this World Affairs Council of Dallas/Fort Worth virtual event below!

GeorgeHWBush #TheManIKnew #FortyOne

https://www.dfwworld.org/events?cgid=1&ceid=267020&cerid=0&cdt=6%2F7%2F2021

June in tomorrow, Tuesday, May 25th at 5pm ET for a conversation between Jean Becker & George Dvorsky, moderated by Adri...
05/24/2021

June in tomorrow, Tuesday, May 25th at 5pm ET for a conversation between Jean Becker & George Dvorsky, moderated by
Adriana Trigiani, about THE MAN I KNEW.

#GeorgeHWBush

June in tomorrow, Tuesday, May 25th at 5pm ET for a conversation between Jean Becker & George Dvorsky, moderated by
Adriana Trigiani, about THE MAN I KNEW.

#GeorgeHWBush

"One can't help noticing some passing similarities between Senator Tammy Duckworth's new memoir and 'Dreams From My Fath...
03/30/2021
Tammy Duckworth Was a Survivor Long Before Her Helicopter Was Shot Down

"One can't help noticing some passing similarities between Senator Tammy Duckworth's new memoir and 'Dreams From My Father,' the memoir Barack Obama published two years before he became state senator." - The New York Times Book Review
https://www.nytimes.com/2021/03/30/books/review/every-day-is-a-gift-tammy-duckworth.html?referringSource=articleShare

The senator from Illinois shares the occasionally harrowing, never boring story of her barrier-breaking life in a new memoir, “Every Day Is a Gift.”

Senator Tammy Duckworth's life, "is an enduring story of how unfailing determination and a refusal to quit can overcome ...
03/30/2021
Review: Tammy Duckworth illustrates a bold refusal to quit

Senator Tammy Duckworth's life, "is an enduring story of how unfailing determination and a refusal to quit can overcome the most difficult challenges." - AP
https://apnews.com/article/entertainment-book-reviews-tammy-duckworth-158756091b272f8bf368fee81857d9e3

“Every Day Is a Gift: A Memoir,” Tammy Duckworth (Twelve/Hachette Book Group) Her fellow crew members initially thought Tammy Duckworth had been killed when a rocket-propelled gr***de...

Listen to the conversation between Senator Tammy Duckworth and Hillary Clinton on "You and Me Both" Podcast. They discus...
03/30/2021
‎You and Me Both with Hillary Clinton: Gutsy Women (with Andra Day & Sen. Tammy Duckworth) on Apple Podcasts

Listen to the conversation between Senator Tammy Duckworth and Hillary Clinton on "You and Me Both" Podcast. They discuss the Senator's new memoir: EVERY DAY IS A GIFT, #AAPI discrimination, and her near-fatal helicopter crash.
https://podcasts.apple.com/us/podcast/gusty-women-with-andra-day-sen-tammy-duckworth/id1531768983?i=1000514984204

‎Show You and Me Both with Hillary Clinton, Ep Gutsy Women (with Andra Day & Sen. Tammy Duckworth) - Mar 30, 2021

The Day Senator Tammy Duckworth's Black Hawk Went Down, via Chicago magazine. Read the exclusive book excerpt from EVERY...
03/30/2021
The Day Tammy Duckworth’s Black Hawk Went Down

The Day Senator Tammy Duckworth's Black Hawk Went Down, via
Chicago magazine. Read the exclusive book excerpt from EVERY DAY IS A GIFT below.
https://www.chicagomag.com/chicago-magazine/april-2021/the-day-tammy-duckworths-black-hawk-went-down/

In an exclusive excerpt from her new book, the U.S. senator from Illinois recounts the dramatic downing of her helicopter in Iraq — and the early stages of recovery from her devastating injuries.

It was Senator Tammy Duckworth's childhood, from fleeing communists in Cambodia, to living in poverty in Hawaii, which i...
03/29/2021
In new book, Duckworth says childhood travails fueled her patriotism, and in an interview doesn’t rule out a future run for president

It was Senator Tammy Duckworth's childhood, from fleeing communists in Cambodia, to living in poverty in Hawaii, which inspired her patriotism, via Chicago Tribune.
https://www.chicagotribune.com/politics/ct-tammy-duckworth-book-20210328-mgp5hzihcvbilcrrtsnlzdnixy-story.html

Sen. Tammy Duckworth of Illinois, who's promoting a memoir set to be released this week, says her childhood travails in Cambodia and elsewhere made her love the United States.

For USA TODAY, Senator Tammy Duckworth spoke to Susan Page about her new memoir EVERY DAY IS A GIFT, as well as her thou...
03/29/2021
Duckworth describes her astonishing life and the Capitol riot: 'I knew I could take care of myself'

For USA TODAY, Senator Tammy Duckworth spoke to Susan Page about her new memoir EVERY DAY IS A GIFT, as well as her thoughts after the Capitol riot on Jan. 6.
https://www.usatoday.com/in-depth/news/politics/2021/03/28/tammy-duckworths-journey-poverty-combat-us-senate/6937121002/

When the Capitol was stormed Jan. 6, Sen. Tammy Duckworth was enraged but not afraid. "I knew I could take care of myself." She always has.

WATCH: Senator Tammy Duckworth joins CBS This Morning to discuss her new book, "Every Day is a Gift," a memoir recountin...
03/29/2021
CBS This Morning on Twitter

WATCH: Senator Tammy Duckworth joins CBS This Morning to discuss her new book, "Every Day is a Gift," a memoir recounting her life from a childhood in Southeast Asia to losing both her legs in Iraq and eventually being elected to the U.S. Senate, via CBS This Morning.
https://twitter.com/CBSThisMorning/status/1376511281742643201

“WATCH: @SenDuckworth joins us to discuss her new book, "Every Day is a Gift," a memoir recounting her life from a childhood in Southeast Asia to losing both her legs in Iraq and eventually being elected to the U.S. Senate. https://t.co/FI84mptVdm”

"It is one thing for a gambler to risk money on a wager. It’s quite another to put his go**ds on the line," about Cousin...
02/02/2021
‘Cousin Sal’ Iacono on gambling with Jimmy Kimmel, Jon Hamm, David Chang

"It is one thing for a gambler to risk money on a wager. It’s quite another to put his go**ds on the line," about Cousin Sal, via New York Post Read about it below!

https://pagesix.com/2021/01/30/cousin-sal-iacono-on-gambling-with-jimmy-kimmel-jon-hamm/?_ga=2.172788129.388760193.1612198639-1998602422.1594746351

Jimmy Kimmel’s cousin has turned ridiculous wagers with stars — including Johnny Knoxville, John Hamm, and more — into a way of life.

Claire McNear, author of ANSWERS IN THE FORM OF QUESTIONS, wrote about Jeopardy!'s search for a new host with a little b...
12/10/2020
The Search for the Next ‘Jeopardy!’ Host

Claire McNear, author of ANSWERS IN THE FORM OF QUESTIONS, wrote about Jeopardy!'s search for a new host with a little bit of help from the Clue Crew, Dan Patrick, and Bob Bergen!

Order the book: https://bit.ly/3kCtz9b
Read all about it here: https://bit.ly/3oM1sWJ

#AlexTrebek #kenjennings #trivianight

Who might be Alex Trebek’s successor? Ken Jennings? Anderson Cooper? LeVar Burton? Dane Cook?!

Hi Coronado! Join Congressman Dan Crenshaw this Sat. 11/07 at McP's Irish Pub from 12-4pm PT, to have a beer outside and...
11/02/2020

Hi Coronado! Join Congressman Dan Crenshaw this Sat. 11/07 at McP's Irish Pub from 12-4pm PT, to have a beer outside and get your copy of FORTITUDE signed by the Congressman!

Extra copies will be provided, but learn more about the book here: https://bit.ly/2HXY5eU

Dan Crenshaw #fortitude #booksigning

Join Jeopardy! Expert Claire McNear, as well as fav contestants: Austin Rogers, Buzzy Cohen, and Pam Mueller on a Behind...
10/23/2020

Join Jeopardy! Expert Claire McNear, as well as fav contestants: Austin Rogers, Buzzy Cohen, and Pam Mueller on a Behind-the-Scenes look at America's favorite game show!

Sign up here: https://bit.ly/31ABoog
Order the book here: https://bit.ly/3kCtz9b

#jeopardy #alextrebek #booktalk

Watch Arvind Gupta & Po Bronson in this week's episode of Hachette Book Group's #TheCurrent. Hear them talk about the mi...
10/09/2020
The Current, Episode 22: Arvind Gupta and Po Bronson

Watch Arvind Gupta & Po Bronson in this week's episode of Hachette Book Group's #TheCurrent. Hear them talk about the mind-bending science as well as their book here: https://bit.ly/2GFNg0M

Order DECODING THE WORLD here: https://bit.ly/3iJ9QU

IndieBio #biotech #COVID__19 #ClimateChange #ScienceMatters

Meet the authors of DECODING THE WORLD: A Roadmap for the Questioner in the latest episode of our weekly author interview series The Current. Authors Arvind ...

Po & Arvind are NOT theorists, they're doers, and they're using #bioengineering to make the world a better place!Look ou...
10/02/2020

Po & Arvind are NOT theorists, they're doers, and they're using #bioengineering to make the world a better place!

Look out for their book DECODING THE WORLD, out on Oct. 6th.
Order now: https://bit.ly/3iJ9QU7

IndieBio #biotech #savingtheworld #science

If we could improve the success rate of picking leadership by 5-10%, it could change the fate of a business." - Coach Br...
10/01/2020

If we could improve the success rate of picking leadership by 5-10%, it could change the fate of a business." - Coach Brian Billick

THE Q FACTOR is out now: https://bit.ly/3cnFzrP

NFL #football #sports #quarterback

Most believe "#biology and #chemistry are two different fields of #science. But in fact they are both manifestations of ...
10/01/2020

Most believe "#biology and #chemistry are two different fields of #science. But in fact they are both manifestations of molecular physics, and it's useful to think of biology as a kind of elegant chemistry" - Po Bronson & Arvind Gupta, DECODING THE WORLD

Order now: https://bit.ly/3iJ9QU7

IndieBio #biotech #decodingtheworld

“Playbooks, plays, schemes, business strategies and plans are good guidelines but without leadership, they never happen....
09/29/2020

“Playbooks, plays, schemes, business strategies and plans are good guidelines but without leadership, they never happen. Playbooks don’t score TDs, leaders do. Business plans don’t make money, leaders do.” - Coach Brian Billick

THE Q FACTOR is out now: https://bit.ly/3cnFzrP

NFL #football #sports #quarterback

How did Po Bronson & Arvind Gupta work together with scientists from Beeflow to save the bees? Find out in DECODING THE ...
09/29/2020

How did Po Bronson & Arvind Gupta work together with scientists from Beeflow to save the bees?

Find out in DECODING THE WORLD out on Oct. 6th!
Order the book: https://bit.ly/3iJ9QU7

IndieBio #savingtheworld #science #biotech #decodingtheworld

Join IndieBio's Po Bronson & Arvind Gupta in their quest to save our world through #biotech, #science and intelligent co...
09/29/2020

Join IndieBio's Po Bronson & Arvind Gupta in their quest to save our world through #biotech, #science and intelligent conversation!

Their new book, DECODING THE WORLD, is out Oct.6.
Order it now: https://bit.ly/3iJ9QU7

“Don’t draft out of “need” – don’t talk yourself into a bad choice, convince yourself you can coach your way out of weak...
09/28/2020

“Don’t draft out of “need” – don’t talk yourself into a bad choice, convince yourself you can coach your way out of weakness.” - Coach Brian Billick

Order THE Q FACTOR: https://bit.ly/3cnFzrP

NFL #football #sports #quarterback

09/28/2020
Decoding the World Book Cover Journey

Join IndieBio's Po Bronson and Arvind Gupta through the 120-year journey that led to the creation of their book cover. Their book: DECODING THE WORLD is out Oct.6!

Order the book now: https://bit.ly/3iJ9QU7

#biotech #savingtheworld #booklovers #bookcover #publishing

"A logical argument can be made that no position on an NFL team is more important than the quarterback.” - Coach Brian B...
09/27/2020

"A logical argument can be made that no position on an NFL team is more important than the quarterback.” - Coach Brian Billick

Order THE Q FACTOR: https://bit.ly/3cnFzrP

NFL #football #sports #quarterback

Discover how #biotech futurists Po Bronson & Arvind Gupta are #savingthebees, printing human organs, capturing CO2 in br...
09/25/2020

Discover how #biotech futurists Po Bronson & Arvind Gupta are #savingthebees, printing human organs, capturing CO2 in bricks, and of course, growing synthetic meat!

DECODING THE WORLD is out Oct. 6.
Order Now: https://bit.ly/3iJ9QU7

IndieBio Beeflow Memphis Meats #savingtheworld #science

“No position in sports is more critical to success than the QB. No position is studied more. And yet, our ability to fin...
09/24/2020

“No position in sports is more critical to success than the QB. No position is studied more. And yet, our ability to find great QBs is less than impressive.” - Coach Brian Billick

Order THE Q FACTOR: https://bit.ly/3cnFzrP

NFL #football #quarterback #superbowl

In Po Bronson & Arvind Gupta's DECODING THE WORLD, the co-authors tackle actual headlines, & discuss how to solve our ti...
09/23/2020

In Po Bronson & Arvind Gupta's DECODING THE WORLD, the co-authors tackle actual headlines, & discuss how to solve our time's most pressing problems through: #science, #biotech, #cleantech and more!

Order the book: https://bit.ly/3iJ9QU7

IndieBio #savingtheworld #science #biotech #decodingtheworld

09/21/2020
Decoding the World: Book Cover DNA Code

DECODING THE WORLD's book cover genetic code is not random. Full code: CTCTGTTAGCGTCTGCTCGTCAGCCTGTGAAGCCTGCTCCTAGTACTGTAGACTCATATCCTA

Decoded & Simplified: NOTHING IS INEVITABLE

Order Po Bronson & Arvind Gupta's book now: http://decodingtheworldbook.com/

IndieBio #biotech #science #bookcover #bookish #publishing

Address

New York, NY
10017

Alerts

Be the first to know and let us send you an email when Twelve Books posts news and promotions. Your email address will not be used for any other purpose, and you can unsubscribe at any time.

Contact The Business

Send a message to Twelve Books:

Videos

Nearby media companies


Comments

Mileage Logbook Book description:- This incredibly simple, and easy-to-use mileage logbook is for anyone who uses their personal car for work or company travel, or for weekend road trips. For whatever your reason, if you need to track, record, and organize your trips, this playfully designed logbook will suit your needs. Use this logbook to organize, track, and record all the important details so you are ready when tax time rolls around. Look at you, going that extra mile! #mileagelogbook #mileage #logbook #book #books #amazon #amazonbook #amazonbooks #bestbook #logbooks #Logbookservice #Logbookservicing
Coronavirus Reflections: Bitter or Better? Book description:- “Coronavirus Reflections: Bitter or Better?” is an invitation to read, reflect and respond to the global pandemic of 2020 and successive months after by author Larada Horner-Miller. Readers are encouraged to think about how the pandemic affected them and how they adapted. The book is intended to be used as a journal, a safe keeping place to revisit 2020. Larada Horner-Miller viewed the forced shelter in place as an opportunity for spiritual discoveries and renewed spiritual growth. The book incorporates what she learned during her year of solitude, a transformative process leading her to find a reconnection with her “God.” She struggled spiritually and emotionally. Her emotions ran deep from fear, struggle, and despair going deeper into her faith, ultimately making Horner-Miller a better, not a bitter person. Themed chapters with poetry and prose add depth to the book. The book is divided into chapters with content developed from the author's blog over the years. Each chapter begins with a carefully chosen thought provoking quote complementing the theme. Horner-Miller's prose and poetry are creative and soul-stirring. Both are extensions of the chapter's theme. Many of the poems deal with the anxiety and depict the universal struggles of uncertainty during this time. Readers will find them inspirational and comforting. Reflective questions at the end of each chapter encourage reader participation to share their personal thoughts and stories as well as process hidden fears and concerns during time spent in quarantine. #coronavirus #coronavirusreflections #coronavirusbitter #coronavirusbetter #coronavirusbitterorbetter #laradahornermiller #books #book #amazonbook #amazonbooks #kindlebook #kindlebooks
GRACE HAS FOUND WAR Book description:- Grace Has found War is a conglomeration of inspirational quotes, well-crafted poems, and life-changing short stories to inspire people from all walks of life. It is an impressive collection of insightful poetry that will touch your heart, give you hope and encourage you to live your life to the fullest and never give up. These masterfully-written short stories, quotes, and poems provide a powerful source of wisdom and inspiration and will make a great addition to any educational or motivational book collection. Each chapter illustrates precision and an in-depth understanding of life by the author. As you progress in the chapters of this book, you would surely come across thought-provoking and empowering words that will uplift and inspire you. In everything we go through in our lives, I believe there is grace behind every war we are bound to face. This book is a dedication to homeless children, my family, and loyal fans. I am honored to inspire people as I inspire myself, life has taught me a lot of things and I sincerely hope this book becomes a part of you and always aspire to never give up. #GRACE #HAS #FOUND #WAR #GRACE_HAS_FOUND_WAR #cracebook #cracebooks #warbook #warbooks #book #books #warm #warsaw #warrior #warriors #warszawa #wardrobe #warsawgirl #warmup #warmth #warnerbros #warehouse #warcraft #warlock #graceful #graceland #gracefulstrength #gracekelly
Version One Is Better Than Version None: 21 Secrets To Build Your Strong Personality. Book description:- Have you any time updated your software in computer? Most of the time you do not bother to the prompt you get, "Do you want to update for version 2.0?" And you choose Ignore until your system is running with mediocre speed. But if there is an attack of virus and subject software is related to eradicate virus from the system, you do not read even two pages of terms and conditions and straight a way push the button 'Yes' Have you ever thought about your own little version? V1>V0. You have to upgrade your four human aspects as physical, mental, emotional and spiritual. My whole series of books are for the paradigm shift from present version to next better version. You can become the best version of yourself, but unfortunately it is not plug and play game. It is just like Chinese bamboo tree. You nurture with adequate fertilisers and water for five years but nothing comes out. After five years bamboo grow almost 100 feet within a couple of weeks and roots grow so deep that no storm can shake the tree. This is true about your own human version too. The primary intent to for writing this book is to update your personality through 21 secrets which are derived from psychological studies and inferences from eminent authors and world class speakers from all over the world. You will following important skills learn from 'Novice' to 'Ninja' · Secret Of Goal Setting · Build Your Strong Personal Brand · Become Your Best When Life Gives You Its Worst · Turn Ideas To Reality · Balance Your Pain And Pleasure · Connect To Your Inner Self Latest version YOU-2.0 is available for download! Do you want to Update? Yes/No or Ignore. But remember, it may be too late when you procrastinate because, "Version One Is Always Better Than Version None" #book #books #amazonbook #amazonbooks #bestbook #bestbooks #buildbook #buildbooks #kindlebook #kindlebooks #strongbook #strongbooks #Version #Better #None #21_Secrets #Build #Strong #Personality #Personalitybooks
Act Like A Warrior : Crush Your Daily Productivity Description:- - > I believe anyone can achieve success in their life. To achieve any kind of success we need to learn many things. Becoming highly productive is one of them. -> Many people believe that setting goals are enough to achieve any kind of success. But everything depends upon planning and implementing those things. -> Learning is not enough we must apply. In my previous book, I have shared my thoughts and ideas related to goal setting. But in this book I am going to share information related to productivity and related topics. -> I am sure this book will work as a guide for anyone how are interested in learning. As usual, this book is written in the simplest way. I have shared those ideas which I have learned from my mentor. #book #books #amazon #amazonbook #amazonbooks #kindle #amazonkindlebook #kindlebook #kindlebooks #ebook #ebooks #amazonebook #amazonebooks #actlikeawarrior #actlikewarrior #crushyourdailyproductivity #crush #productivity #success #planning #Learning #Learn
The Power Of Goal Setting: Learn Why Do People Fail, Why Goals Are Important, And How To Set, And Achieve Them? Description:- Do you know out of every hundred people who set their goals only eight of them will do everything to achieve their target? Yes, this is a shocking fact but it’s true. Just like any river without water will be of no use, in the same way, a life without goals will be meaningless. In simple words, goals give us direction in our life and we can be sure enough that we are moving in the right direction. But simply having a goal is not enough and you will understand this concept after reading this book. Everybody wants to achieve goals in their life. What are the secrets of achieving them? Let me ask some important questions related to life and your career. Do you believe in your dreams? Do you believe in your abilities and skills? Do you make your dreams your goals? Are you ready to learn and implement new skills? Do you know how many types of goals are there? Now, here is the secret to achieving your goals. Goals are achieved based on our daily habits and plans. They are not achieved based on random thoughts. Before we decide any an action plan we need to see what habits we need to build. What kind of discipline do we need to have? Are you ready to do the hard work? Are you willing to work till late at night and ready to get up as soon as possible? Are you ready to push your limits? What daily routines will you follow? Life is unpredictable and complicated, so are you ready for that? We need to see many things before we make a detailed action plan and goals. This book – The Power Of Goal Setting will introduce you to every aspect of goal setting and why they are the most crucial elements for growth in life. Here is what you will learn from – The Power Of Goal Setting Chapter 1: Why Setting The Right Goals Are Important? Chapter 2: Why Do People Fail Despite Goal Setting? Chapter 3: How To Set Goals, Progress, And Achieve them? Chapter 4: Successful Habits To Achieve Any Goals Chapter 5: 5 Types Of Goals Every Individual Should Set What I Achieved Last Year? As a writer, I dedicated 2020; writing articles and I managed to write over 160+ articles. Also, I was able to win an article writing contest four times in a row. This year I have set my goal of writing six books by May 2021. I am writing books on different categories and I am sure I can achieve my goal. This book will tell you why there is a need to set the right kinds of goals and what the successful habits to achieve goals. And as an author of this book, I have shared my personal goals to show you that achieving goals is really possible. If you are ready to work towards your goal this book will guide you. And I am also sharing about five different kinds of goals that every individual should have. So, grab this opportunity and understand some fundamentals of achieving your goals. #vikrambrahma #book #books #amazonbook #amazonbooks #Kindle #Kindlebooks #power #goal #learn #achieve #thepowerofGoalsetting #goalSetting #learnwhydopeoplefail #whygoalsareimportant #successful #habits #SuccessfulHabits #dreams #skills #bestbook #bestbooks #bestamazon #bestamazonbook #bestamazonbooks